miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-487b-3p | ||||
| miRNA Stemloop AC | MI0003530 | ||||
| miRNA Stemloop ID | hsa-mir-487b | ||||
| Sequence | aaucguacagggucauccacuu | ||||
| TTD Target(s) Regulated by This miRNA | Metabotropic glutamate receptor 3 (mGluR3) | Clinical trial Target | Target Info | [1] | |
| Thrombospondin-1 (THBS1) | Clinical trial Target | Target Info | [2] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [3] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [3] | ||
| Wnt-5a protein (WNT5A) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 2 | Regulated Protein | [4] | ||
| Polycomb protein SUZ12 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | The miR-487b-3p/GRM3/TGF signaling axis is an important regulator of colon cancer tumorigenesis. Oncogene. 2017 Jun 15;36(24):3477-3489. | ||||
| REF 2 | miR-487b promotes human umbilical vein endothelial cell proliferation, migration, invasion and tube formation through regulating THBS1. Neurosci Lett. 2015 Mar 30;591:1-7. | ||||
| REF 3 | Cigarette smoke mediates epigenetic repression of miR-487b during pulmonary carcinogenesis. J Clin Invest. 2013 Mar;123(3):1241-61. | ||||
| REF 4 | MiR-134/487b/655 cluster regulates TGF--induced epithelial-mesenchymal transition and drug resistance to gefitinib by targeting MAGI2 in lung adenocarcinoma cells.Mol Cancer Ther. 2014 Feb;13(2):444-53. | ||||
| REF 5 | Cigarette smoke mediates epigenetic repression of miR-487b during pulmonary carcinogenesis. J Clin Invest. 2013 Mar;123(3):1241-61. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.