miRNA General Information
miRNA Mature ID	hsa-miR-492
miRNA Stemloop AC	MI0003131
miRNA Stemloop ID	hsa-mir-492
Sequence	aggaccugcgggacaagauucuu
TTD Target(s) Regulated by This miRNA	Serum albumin (ALB)	Successful Target	Target Info	[1]
	Basigin (BSG)	Clinical trial Target	Target Info	[2]
	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[3]
	Multiple tumor suppressor 1 (CDKN2A)	Literature-reported Target	Target Info	[1]
Protein(s) Regulated by This miRNA	3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 1	Regulated Protein	3BHS1_HUMAN	[1]
	Beta-galactoside alpha-2,6-sialyltransferase 1	Regulated Protein	SIAT1_HUMAN	[1]
	BH3-interacting domain death agonist	Regulated Protein	BID_HUMAN	[1]
	Bile acid-CoA:amino acid N-acyltransferase	Regulated Protein	BAAT_HUMAN	[1]
	Graves disease carrier protein	Regulated Protein	GDC_HUMAN	[1]
	Myeloid zinc finger 1	Regulated Protein	MZF1_HUMAN	[5]
	Transcription factor 21	Regulated Protein	TCF21_HUMAN	[1]
References
REF 1	MicroRNA-492 is processed from the keratin 19 gene and up-regulated in metastatic hepatoblastoma. Hepatology. 2011 Mar;53(3):833-42.
REF 2	MiR-492 is functionally involved in Oxaliplatin resistance in colon cancer cells LS174T via its regulating the expression of CD147. Mol Cell Biochem. 2015 Jul;405(1-2):73-9.
REF 3	MicroRNA-492 expression promotes the progression of hepatic cancer by targeting PTEN. Cancer Cell Int. 2014 Sep 20;14(1):95.
REF 4	MicroRNA-492 is processed from the keratin 19 gene and up-regulated in metastatic hepatoblastoma. Hepatology. 2011 Mar;53(3):833-42.
REF 5	Myeloid zinc-finger 1 (MZF-1) suppresses prostate tumor growth through enforcing ferroportin-conducted iron egress.Oncogene. 2015 Jul;34(29):3839-47.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.