miRNA General Information
miRNA Mature ID	hsa-miR-494-5p
miRNA Stemloop AC	MI0003134
miRNA Stemloop ID	hsa-mir-494
Sequence	agguuguccguguugucuucucu
TTD Target(s) Regulated by This miRNA	C-X-C chemokine receptor type 4 (CXCR4)	Successful Target	Target Info	[1]
	Dihydrothymine dehydrogenase (DPYD)	Successful Target	Target Info	[2]
	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[3]
References
REF 1	miR-494 suppresses the progression of breast cancer in vitro by targeting CXCR4 through the Wnt/-catenin signaling pathway. Oncol Rep. 2015 Jul;34(1):525-31.
REF 2	MicroRNA-494 sensitizes colon cancer cells to fluorouracil through regulation of DPYD. IUBMB Life. 2015 Mar;67(3):191-201.
REF 3	miR-494 promotes cell proliferation, migration and invasion, and increased sorafenib resistance in hepatocellular carcinoma by targeting PTEN. Oncol Rep. 2015 Aug;34(2):1003-10.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.