miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-503-3p | ||||
| miRNA Stemloop AC | MI0003188 | ||||
| miRNA Stemloop ID | hsa-mir-503 | ||||
| Sequence | gggguauuguuuccgcugccagg | ||||
| TTD Target(s) Regulated by This miRNA | Interleukin-2 (IL2) | Successful Target | Target Info | [1] | |
| Interleukin-10 (IL10) | Clinical trial Target | Target Info | [1] | ||
| Interleukin-4 (IL4) | Clinical trial Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Interferon alpha-1/13 | Regulated Protein | [1] | ||
| Mothers against decapentaplegic homolog 2 | Regulated Protein | [3] | |||
| Neural cell adhesion molecule L1 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | Effect of miR-503 Down-Regulation on Growth and Invasion of Esophagus Carcinoma and Related Immune Function. Med Sci Monit. 2015 Nov 18;21:3564-9. | ||||
| REF 2 | Effect of miR-503 Down-Regulation on Growth and Invasion of Esophagus Carcinoma and Related Immune Function. Med Sci Monit. 2015 Nov 18;21:3564-9. | ||||
| REF 3 | miR-503-3p promotes epithelial-mesenchymal transition in breast cancer by directly targeting SMAD2 and E-cadherin.J Genet Genomics. 2017 Feb 20;44(2):75-84. | ||||
| REF 4 | miR-503 inhibits cell proliferation and invasion in glioma by targeting L1CAM. Int J Clin Exp Med. 2015 Oct 15;8(10):18441-7. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.