miRNA General Information
miRNA Mature ID	hsa-miR-505-5p
miRNA Stemloop AC	MI0003190
miRNA Stemloop ID	hsa-mir-505
Sequence	gggagccaggaaguauugaugu
TTD Target(s) Regulated by This miRNA	Cyclic-AMP-dependent transcription factor ATF-3 (ATF3)	Literature-reported Target	Target Info	[1]
References
REF 1	miRNA expression pattern associated with prognosis in elderly patients with advanced OPSC and OCC. Int J Oncol. 2013 Sep;43(3):839-49.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.