miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-509-3-5p | ||||
| miRNA Stemloop AC | MI0005717 | ||||
| miRNA Stemloop ID | hsa-mir-509-3 | ||||
| Sequence | uacugcagacguggcaaucaug | ||||
| TTD Target(s) Regulated by This miRNA | Polo-like kinase 1 (PLK1) | Clinical trial Target | Target Info | [1] | |
| Forkhead box protein M1 (FOXM1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Podocalyxin | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | MiR-509-3-5p causes aberrant mitosis and anti-proliferative effect by suppression of PLK1 in human lung cancer A549 cells. Biochem Biophys Res Commun. 2016 Sep 16;478(2):676-82. | ||||
| REF 2 | The Tumor Suppressive Role of MiRNA-509-5p by Targeting FOXM1 in Non-Small Cell Lung Cancer. Cell Physiol Biochem. 2016;38(4):1435-46. | ||||
| REF 3 | miR-509-3-5P inhibits the invasion and lymphatic metastasis by targeting PODXL and serves as a novel prognostic indicator for gastric cancer.Oncotarget. 2017 May 23;8(21):34867-34883. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.