miRNA General Information
miRNA Mature ID	hsa-miR-509-3p
miRNA Stemloop AC	MI0003196 | MI0005530 | MI0005717
miRNA Stemloop ID	hsa-mir-509-1 | hsa-mir-509-2 | hsa-mir-509-3
Sequence	ugauugguacgucuguggguag
TTD Target(s) Regulated by This miRNA	NT-3 growth factor receptor (TrkC)	Successful Target	Target Info	[1]
References
REF 1	The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells. Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.