miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-510-5p | ||||
| miRNA Stemloop AC | MI0003197 | ||||
| miRNA Stemloop ID | hsa-mir-510 | ||||
| Sequence | uacucaggagaguggcaaucac | ||||
| TTD Target(s) Regulated by This miRNA | Prostate derived ETS factor (SPDEF) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | 5-hydroxytryptamine receptor 3E | Regulated Protein | [2] | ||
| Peroxiredoxin-1 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | MicroRNA-mediated inhibition of prostate-derived Ets factor messenger RNA translation affects prostate-derived Ets factor regulatory networks in human breast cancer. Cancer Res. 2008 Oct 15;68(20):8499-506. | ||||
| REF 2 | First evidence for an association of a functional variant in the microRNA-510 target site of the serotonin receptor-type 3E gene with diarrhea predominant irritable bowel syndrome.Hum Mol Genet. 2008 Oct 1;17(19):2967-77. | ||||
| REF 3 | MicroRNA-510 promotes cell and tumor growth by targeting peroxiredoxin1 in breast cancer.Breast Cancer Res. 2013;15(4):R70. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.