miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-511-5p | ||||
| miRNA Stemloop AC | MI0003127 | ||||
| miRNA Stemloop ID | hsa-mir-511 | ||||
| Sequence | gugucuuuugcucugcaguca | ||||
| TTD Target(s) Regulated by This miRNA | FK506-binding protein 5 (FKBP5) | Literature-reported Target | Target Info | [1] | |
| Tripartite motif-containing 24 (TRIM24) | Literature-reported Target | Target Info | [2] | ||
| Liver organic anion transporter 1 (SLCO1B1) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Homeobox protein prophet of Pit-1 | Regulated Protein | [4] | ||
| Tribbles homolog 2 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | MicroRNA-511 Binds to FKBP5 mRNA, Which Encodes a Chaperone Protein, and Regulates Neuronal Differentiation. J Biol Chem. 2016 Aug 19;291(34):17897-906. | ||||
| REF 2 | Regulation of TRIM24 by miR-511 modulates cell proliferation in gastric cancer. J Exp Clin Cancer Res. 2017 Jan 23;36(1):17. | ||||
| REF 3 | Role of miR-511 in the Regulation of OATP1B1 Expression by Free Fatty Acid. Biomol Ther (Seoul). 2015 Sep;23(5):400-6. | ||||
| REF 4 | Circulating microRNA profiles and the identification of miR-593 and miR-511 which directly target the PROP1 gene in children with combined pituitary hormone deficiency.Int J Mol Med. 2015 Feb;35(2):358-66. | ||||
| REF 5 | miR-511 and miR-1297 inhibit human lung adenocarcinoma cell proliferation by targeting oncogene TRIB2.PLoS One. 2012;7(10):e46090. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.