miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-522-3p | ||||
| miRNA Stemloop AC | MI0003177 | ||||
| miRNA Stemloop ID | hsa-mir-522 | ||||
| Sequence | aaaaugguucccuuuagagugu | ||||
| TTD Target(s) Regulated by This miRNA | Transcription factor SOX-2 (SOX2) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | DENN domain-containing protein 2D | Regulated Protein | [2] | ||
| Frataxin, mitochondrial | Regulated Protein | [3] | |||
| Prostaglandin reductase 1 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | MicroRNA-126 inhibits SOX2 expression and contributes to gastric carcinogenesis. PLoS One. 2011 Jan 27;6(1):e16617. | ||||
| REF 2 | Downregulation of miR-522 suppresses proliferation and metastasis of non-small cell lung cancer cells by directly targeting DENN/MADD domain containing 2D.Sci Rep. 2016 Jan 19;6:19346. | ||||
| REF 3 | Genetic variations creating microRNA target sites in the FXN 3'-UTR affect frataxin expression in Friedreich ataxia.PLoS One. 2013;8(1):e54791. | ||||
| REF 4 | Novel involvement of miR-522-3p in high-mobility group box 1-induced prostaglandin reductase 1 expression and reduction of phagocytosis.Biochim Biophys Acta Mol Cell Res. 2017 Apr;1864(4):625-633. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.