miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-525-3p | ||||
| miRNA Stemloop AC | MI0003152 | ||||
| miRNA Stemloop ID | hsa-mir-525 | ||||
| Sequence | gaaggcgcuucccuuuagagcg | ||||
| TTD Target(s) Regulated by This miRNA | Beta-arrestin-1 (ARRB1) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Peptidyl-prolyl cis-trans isomerase G | Regulated Protein | [1] | ||
| S-formylglutathione hydrolase | Regulated Protein | [1] | |||
| Zinc finger protein 395 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | Cell survival following radiation exposure requires miR-525-3p mediated suppression of ARRB1 and TXN1. PLoS One. 2013 Oct 16;8(10):e77484. | ||||
| REF 2 | Cell survival following radiation exposure requires miR-525-3p mediated suppression of ARRB1 and TXN1. PLoS One. 2013 Oct 16;8(10):e77484. | ||||
| REF 3 | MiR-525-3p enhances the migration and invasion of liver cancer cells by downregulating ZNF395.PLoS One. 2014 Mar 5;9(3):e90867. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.