miRNA General Information
miRNA Mature ID	hsa-miR-544a
miRNA Stemloop AC	MI0003515
miRNA Stemloop ID	hsa-mir-544a
Sequence	auucugcauuuuuagcaaguuc
TTD Target(s) Regulated by This miRNA	Signal transducer and activator of transcription 3 (STAT3)	Successful Target	Target Info	[1]
	Polycomb complex protein BMI-1 (BMI1)	Clinical trial Target	Target Info	[2]
	Epithelial cadherin (CDH1)	Literature-reported Target	Target Info	[3]
Protein(s) Regulated by This miRNA	B-cell lymphoma 6 protein	Regulated Protein	BCL6_HUMAN	[1]
	Homeobox protein Hox-A10	Regulated Protein	HXA10_HUMAN	[5]
References
REF 1	MicroRNA-544 down-regulates both Bcl6 and Stat3 to inhibit tumor growth of human triple negative breast cancer. Biol Chem. 2016 Oct 1;397(10):1087-95.
REF 2	MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707.
REF 3	miR-544a promotes the invasion of lung cancer cells by targeting cadherina 1 in vitro. Onco Targets Ther. 2014 Jun 4;7:895-900.
REF 4	MicroRNA-544 down-regulates both Bcl6 and Stat3 to inhibit tumor growth of human triple negative breast cancer. Biol Chem. 2016 Oct 1;397(10):1087-95.
REF 5	MicroRNA-544a Regulates Migration and Invasion in Colorectal Cancer Cells via Regulation of Homeobox A10.Dig Dis Sci. 2016 Sep;61(9):2535-44.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.