miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-548c-3p | ||||
| miRNA Stemloop AC | MI0003630 | ||||
| miRNA Stemloop ID | hsa-mir-548c | ||||
| Sequence | caaaaaucucaauuacuuuugc | ||||
| TTD Target(s) Regulated by This miRNA | Integrin alpha-V (ITGAV) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Twist-related protein 1 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Decreased Expression of miR-548c-3p in Osteosarcoma Contributes to Cell Proliferation Via Targeting ITGAV. Cancer Biother Radiopharm. 2016 Jun;31(5):153-8. | ||||
| REF 2 | MiR-548c impairs migration and invasion of endometrial and ovarian cancer cells via downregulation of Twist.J Exp Clin Cancer Res. 2016 Jan 13;35:10. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.