miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-5582-5p | ||||
| miRNA Stemloop AC | MI0019138 | ||||
| miRNA Stemloop ID | hsa-mir-5582 | ||||
| Sequence | uaggcacacuuaaaguuauagc | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Alpha-1B-glycoprotein | Regulated Protein | [1] | ||
| SHC-transforming protein 1 | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | Novel miR-5582-5p functions as a tumor suppressor by inducing apoptosis and cell cycle arrest in cancer cells through direct targeting of GAB1, SHC1, and CDK2. Biochim Biophys Acta. 2016 Oct;1862(10):1926-37. | ||||
| REF 2 | Novel miR-5582-5p functions as a tumor suppressor by inducing apoptosis and cell cycle arrest in cancer cells through direct targeting of GAB1, SHC1, and CDK2. Biochim Biophys Acta. 2016 Oct;1862(10):1926-37. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.