miRNA General Information
miRNA Mature ID	hsa-miR-570-3p
miRNA Stemloop AC	MI0003577
miRNA Stemloop ID	hsa-mir-570
Sequence	cgaaaacagcaauuaccuuugc
TTD Target(s) Regulated by This miRNA	Programmed cell death 1 ligand 1 (PD-L1)	Successful Target	Target Info	[1]
References
REF 1	A miR-570 binding site polymorphism in the B7-H1 gene is associated with the risk of gastric adenocarcinoma. Hum Genet. 2013 Jun;132(6):641-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.