miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-589-5p | ||||
| miRNA Stemloop AC | MI0003599 | ||||
| miRNA Stemloop ID | hsa-mir-589 | ||||
| Sequence | ugagaaccacgucugcucugag | ||||
| TTD Target(s) Regulated by This miRNA | Prostaglandin G/H synthase 2 (COX-2) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Frataxin, mitochondrial | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Promoter RNA links transcriptional regulation of inflammatory pathway genes. Nucleic Acids Res. 2013 Dec;41(22):10086-109. | ||||
| REF 2 | Genetic variations creating microRNA target sites in the FXN 3'-UTR affect frataxin expression in Friedreich ataxia.PLoS One. 2013;8(1):e54791. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.