miRNA General Information
miRNA Mature ID hsa-miR-590-5p
miRNA Stemloop AC MI0003602
miRNA Stemloop ID hsa-mir-590
Sequence gagcuuauucauaaaagugcag
TTD Target(s) Regulated by This miRNA Transforming growth factor beta 1 (TGFB1) Successful Target Target Info [1]
TGF-beta receptor type II (TGFBR2) Clinical trial Target Target Info [2]
Lectin-like oxidized LDL receptor (OLR1) Clinical trial Target Target Info [3]
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Literature-reported Target Target Info [4]
Suppressor of tumorigenicity 15 protein (ST15) Literature-reported Target Target Info [5]
Mothers against decapentaplegic homolog 3 (SMAD3) Preclinical Target Target Info [6]
Protein(s) Regulated by This miRNA Cyclic AMP-responsive element-binding protein 5 Regulated Protein [7]
Interleukin enhancer-binding factor 3 Regulated Protein [8]
Neural cell adhesion molecule L1-like protein Regulated Protein [9]
Protein BTG2 Regulated Protein [10]
Retinoblastoma-associated protein Regulated Protein [11]
References
REF 1 miRNA expression profile of vulvar squamous cell carcinoma and identification of the oncogenic role of miR-590-5p. Oncol Rep. 2016 Jan;35(1):398-408.
REF 2 Downregulation of miR-133 and miR-590 contributes to nicotine-induced atrial remodelling in canines. Cardiovasc Res. 2009 Aug 1;83(3):465-72.
REF 3 MicroRNA-155 silencing enhances inflammatory response and lipid uptake in oxidized low-density lipoprotein-stimulated human THP-1 macrophages. J Investig Med. 2010 Dec;58(8):961-7.
REF 4 A feedback expression of microRNA-590 and activating transcription factor-3 in human breast cancer cells. Int J Biol Macromol. 2015 Jan;72:145-50.
REF 5 miR-590-5p regulates gastric cancer cell growth and chemosensitivity through RECK and the AKT/ERK pathway. Onco Targets Ther. 2016 Oct 3;9:6009-6019.
REF 6 Hsa-miR-590-5p Interaction with SMAD3 Transcript Supports Its Regulatory Effect on The TGF Signaling Pathway. Cell J. 2016 Spring;18(1):7-12.
REF 7 MiR-582-5p/miR-590-5p targeted CREB1/CREB5-NF-B signaling and caused opioid-induced immunosuppression in human monocytes. Transl Psychiatry. 2016 Mar 15;6:e757.
REF 8 MiR-590-5p inhibits colorectal cancer angiogenesis and metastasis by regulating nuclear factor 90/vascular endothelial growth factor A axis.Cell Death Dis. 2016 Oct 13;7(10):e2413.
REF 9 MicroRNA-590 promotes cervical cancer cell growth and invasion by targeting CHL1.J Cell Biochem. 2014 May;115(5):847-53.
REF 10 SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes.Nat Commun. 2015 Sep 23;6:8257.
REF 11 miR-590 promotes cell proliferation and invasion in T-cell acute lymphoblastic leukaemia by inhibiting RB1.Oncotarget. 2016 Jun 28;7(26):39527-39534.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.