miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-613 | ||||
| miRNA Stemloop AC | MI0003626 | ||||
| miRNA Stemloop ID | hsa-mir-613 | ||||
| Sequence | aggaauguuccuucuuugcc | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [1] | |
| ATP-binding cassette transporter A1 (ABCA1) | Successful Target | Target Info | [2] | ||
| Brain-derived neurotrophic factor (BDNF) | Clinical trial Target | Target Info | [3] | ||
| Oxysterols receptor LXR-alpha (NR1H3) | Patented-recorded Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Metalloproteinase inhibitor 3 | Regulated Protein | [5] | ||
| References | |||||
| REF 1 | MiR-613 induces cell cycle arrest by targeting CDK4 in non-small cell lung cancer. Cell Oncol (Dordr). 2016 Apr;39(2):139-47. | ||||
| REF 2 | miR-613 regulates cholesterol efflux by targeting LXR and ABCA1 in PPAR activated THP-1 macrophages. Biochem Biophys Res Commun. 2014 Jun 6;448(3):329-34. | ||||
| REF 3 | MicroRNA-613 regulates the expression of brain-derived neurotrophic factor in Alzheimer's disease. Biosci Trends. 2016 Nov 15;10(5):372-377. | ||||
| REF 4 | MicroRNA hsa-miR-613 targets the human LXR gene and mediates a feedback loop of LXR autoregulation. Mol Endocrinol. 2011 Apr;25(4):584-96. | ||||
| REF 5 | Integrated analyses of microRNA and mRNA expression profiles in aggressive papillary thyroid carcinoma.Mol Med Rep. 2013 Nov;8(5):1353-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.