miRNA General Information
miRNA Mature ID	hsa-miR-617
miRNA Stemloop AC	MI0003631
miRNA Stemloop ID	hsa-mir-617
Sequence	agacuucccauuugaagguggc
TTD Target(s) Regulated by This miRNA	NT-3 growth factor receptor (TrkC)	Successful Target	Target Info	[1]
References
REF 1	Allele variants in functional MicroRNA target sites of the neurotrophin-3 receptor gene (NTRK3) as susceptibility factors for anxiety disorders. Hum Mutat. 2009 Jul;30(7):1062-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.