miRNA General Information
miRNA Mature ID	hsa-miR-627-5p
miRNA Stemloop AC	MI0003641
miRNA Stemloop ID	hsa-mir-627
Sequence	gugagucucuaagaaaagagga
TTD Target(s) Regulated by This miRNA	Lysine-specific demethylase 3A (KDM3A)	Literature-reported Target	Target Info	[1]
References
REF 1	MicroRNA-627 mediates the epigenetic mechanisms of vitamin D to suppress proliferation of human colorectal cancer cells and growth of xenograft tumors in mice. Gastroenterology. 2013 Aug;145(2):437-46.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.