miRNA General Information
miRNA Mature ID	hsa-miR-628-3p
miRNA Stemloop AC	MI0003642
miRNA Stemloop ID	hsa-mir-628
Sequence	ucuaguaagaguggcagucga
TTD Target(s) Regulated by This miRNA	Runt-related transcription factor 2 (RUNX2)	Literature-reported Target	Target Info	[1]
References
REF 1	MicroRNA hsa-miR-135b regulates mineralization in osteogenic differentiation of human unrestricted somatic stem cells. Stem Cells Dev. 2010 Jun;19(6):877-85.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.