miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-628-5p | ||||
| miRNA Stemloop AC | MI0003642 | ||||
| miRNA Stemloop ID | hsa-mir-628 | ||||
| Sequence | augcugacauauuuacuagagg | ||||
| TTD Target(s) Regulated by This miRNA | Insulin receptor substrate-1 (IRS1) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Actin-binding Rho-activating protein | Regulated Protein | [2] | ||
| HLA class I histocompatibility antigen, alpha chain G | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | miR-628 Promotes Burn-Induced Skeletal Muscle Atrophy via Targeting IRS1. Int J Biol Sci. 2016 Sep 15;12(10):1213-1224. | ||||
| REF 2 | Striated muscle activator of Rho signalling (STARS) is reduced in ageing human skeletal muscle and targeted by miR-628-5p.Acta Physiol (Oxf). 2017 Jun;220(2):263-274. | ||||
| REF 3 | Identification of novel microRNAs regulating HLA-G expression and investigating their clinical relevance in renal cell carcinoma.Oncotarget. 2016 May 3;7(18):26866-78. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.