miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-633 | ||||
| miRNA Stemloop AC | MI0003648 | ||||
| miRNA Stemloop ID | hsa-mir-633 | ||||
| Sequence | cuaauaguaucuaccacaauaaa | ||||
| TTD Target(s) Regulated by This miRNA | Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [1] | |
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | Resveratrol modulates the levels of microRNAs targeting genes encoding tumor-suppressors and effectors of TGF signaling pathway in SW480 cells. Biochem Pharmacol. 2010 Dec 15;80(12):2057-65. | ||||
| REF 2 | miR-663a inhibits hepatocellular carcinoma cell proliferation and invasion by targeting HMGA2. Biomed Pharmacother. 2016 Jul;81:431-438. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.