miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-659-3p | ||||
| miRNA Stemloop AC | MI0003683 | ||||
| miRNA Stemloop ID | hsa-mir-659 | ||||
| Sequence | cuugguucagggagggucccca | ||||
| TTD Target(s) Regulated by This miRNA | Sphingosine kinase 1 (SPHK1) | Clinical trial Target | Target Info | [1] | |
| Granulin (GRN) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | miR-659-3p is involved in the regulation of the chemotherapy response of colorectal cancer via modulating the expression of SPHK1. Am J Cancer Res. 2016 Sep 1;6(9):1976-1985. | ||||
| REF 2 | Common variation in the miR-659 binding-site of GRN is a major risk factor for TDP43-positive frontotemporal dementia. Hum Mol Genet. 2008 Dec 1;17(23):3631-42. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.