miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-664b-5p | ||||
miRNA Stemloop AC | MI0019134 | ||||
miRNA Stemloop ID | hsa-mir-664b | ||||
Sequence | ugggcuaagggagaugauugggua | ||||
TTD Target(s) Regulated by This miRNA | G1/S-specific cyclin-E2 (CCNE2) | Literature-reported Target | Target Info | [1] | |
References | |||||
REF 1 | PARP inhibitor increases chemosensitivity by upregulating miR-664b-5p in BRCA1-mutated triple-negative breast cancer. Sci Rep. 2017 Feb 8;7:42319. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.