miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-665 | ||||
| miRNA Stemloop AC | MI0005563 | ||||
| miRNA Stemloop ID | hsa-mir-665 | ||||
| Sequence | accaggaggcugaggccccu | ||||
| TTD Target(s) Regulated by This miRNA | Cannabinoid receptor 2 (CB2) | Successful Target | Target Info | [1] | |
| Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase gamma-1 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | MicroRNA-665 is involved in the regulation of the expression of the cardioprotective cannabinoid receptor CB2 in patients with severe heart failure. Biochem Biophys Res Commun. 2014 Sep 5;451(4):516-21. | ||||
| REF 2 | Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80. | ||||
| REF 3 | Screening of differential microRNA expression in gastric signet ring cell carcinoma and gastric adenocarcinoma and target gene prediction.Oncol Rep. 2015 Jun;33(6):2963-71. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.