miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-671-5p | ||||
| miRNA Stemloop AC | MI0003760 | ||||
| miRNA Stemloop ID | hsa-mir-671 | ||||
| Sequence | aggaagcccuggaggggcuggag | ||||
| TTD Target(s) Regulated by This miRNA | Forkhead box protein M1 (FOXM1) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Cerebellar degeneration-related antigen 1 | Regulated Protein | [2] | ||
| SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | miR-671-5p inhibits epithelial-to-mesenchymal transition by downregulating FOXM1 expression in breast cancer. Oncotarget. 2016 Jan 5;7(1):293-307. | ||||
| REF 2 | miRNA-dependent gene silencing involving Ago2-mediated cleavage of a circular antisense RNA.EMBO J. 2011 Sep 30;30(21):4414-22. | ||||
| REF 3 | SMARCB1 expression in epithelioid sarcoma is regulated by miR-206, miR-381, and miR-671-5p on Both mRNA and protein levels.Genes Chromosomes Cancer. 2014 Feb;53(2):168-76. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.