miRNA General Information
miRNA Mature ID	hsa-miR-744-3p
miRNA Stemloop AC	MI0005559
miRNA Stemloop ID	hsa-mir-744
Sequence	cuguugccacuaaccucaaccu
TTD Target(s) Regulated by This miRNA	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[1]
Protein(s) Regulated by This miRNA	Programmed cell death protein 4	Regulated Protein	PDCD4_HUMAN	[1]
References
REF 1	MicroRNA 744-3p promotes MMP-9-mediated metastasis by simultaneously suppressing PDCD4 and PTEN in laryngeal squamous cell carcinoma. Oncotarget. 2016 Sep 6;7(36):58218-58233.
REF 2	MicroRNA 744-3p promotes MMP-9-mediated metastasis by simultaneously suppressing PDCD4 and PTEN in laryngeal squamous cell carcinoma. Oncotarget. 2016 Sep 6;7(36):58218-58233.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.