miRNA General Information
miRNA Mature ID	hsa-miR-758-3p
miRNA Stemloop AC	MI0003757
miRNA Stemloop ID	hsa-mir-758
Sequence	uuugugaccugguccacuaacc
TTD Target(s) Regulated by This miRNA	ATP-binding cassette transporter A1 (ABCA1)	Successful Target	Target Info	[1]
	Toll-like receptor 7 (TLR7)	Successful Target	Target Info	[2]
	Toll-like receptor 3 (TLR3)	Clinical trial Target	Target Info	[2]
References
REF 1	MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science. 2010 Jun 18;328(5985):1566-9.
REF 2	Hepatitis C virus infection decreases the expression of Toll-like receptors 3 and 7 via upregulation of miR-758. Arch Virol. 2014 Nov;159(11):2997-3003.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.