miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-760 | ||||
| miRNA Stemloop AC | MI0005567 | ||||
| miRNA Stemloop ID | hsa-mir-760 | ||||
| Sequence | cggcucugggucugugggga | ||||
| TTD Target(s) Regulated by This miRNA | Casein kinase II alpha (CSNK2A1) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Histone H2A type 1-D | Regulated Protein | [2] | ||
| Histone H3.1 | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | MiR-186, miR-216b, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting subunit of protein kinase CKII in human colorectal cancer cells. Biochem Biophys Res Commun. 2012 Dec 14;429(3-4):173-9. | ||||
| REF 2 | Contrasting expression patterns of histone mRNA and microRNA 760 in patients with gastric cancer.Clin Cancer Res. 2013 Dec 1;19(23):6438-49. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.