miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-762 | ||||
| miRNA Stemloop AC | MI0003892 | ||||
| miRNA Stemloop ID | hsa-mir-762 | ||||
| Sequence | ggggcuggggccggggccgagc | ||||
| TTD Target(s) Regulated by This miRNA | S-adenosylmethionine decarboxylase proenzyme (AMD1) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Interferon regulatory factor 7 | Regulated Protein | [2] | ||
| Interferon-induced transmembrane protein 5 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | AMD1 is essential for ESC self-renewal and is translationally down-regulated on differentiation to neural precursor cells. Genes Dev. 2012 Mar 1;26(5):461-73. | ||||
| REF 2 | microRNA-762 promotes breast cancer cell proliferation and invasion by targeting IRF7 expression.Cell Prolif. 2015 Dec;48(6):643-9. | ||||
| REF 3 | Effects of targeted modulation of miR-762 on expression of the IFITM5 gene in Saos-2 cells.Intractable Rare Dis Res. 2014 Feb;3(1):12-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.