miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-765 | ||||
| miRNA Stemloop AC | MI0005116 | ||||
| miRNA Stemloop ID | hsa-mir-765 | ||||
| Sequence | uggaggagaaggaaggugaug | ||||
| TTD Target(s) Regulated by This miRNA | NT-3 growth factor receptor (TrkC) | Successful Target | Target Info | [1] | |
| Hepatocyte nuclear factor 4-alpha (HNF4A) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Epithelial membrane protein 3 | Regulated Protein | [3] | ||
| Transcription factor HES-1 | Regulated Protein | [4] | |||
| Type II inositol 3,4-bisphosphate 4-phosphatase | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells. Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62. | ||||
| REF 2 | In silico and in vitro identification of microRNAs that regulate hepatic nuclear factor 4 expression. Drug Metab Dispos. 2012 Apr;40(4):726-33. | ||||
| REF 3 | Epithelial membrane protein 3 functions as an oncogene and is regulated by microRNA-765 in primary breast carcinoma.Mol Med Rep. 2015 Nov;12(5):6445-50. | ||||
| REF 4 | MicroRNA-765 regulates neural stem cell proliferation and differentiation by modulating Hes1 expression. Am J Transl Res. 2016 Jul 15;8(7):3115-23. | ||||
| REF 5 | Mir-765 promotes cell proliferation by downregulating INPP4B expression in human hepatocellular carcinoma.Cancer Biomark. 2016;16(3):405-13. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.