miRNA General Information
miRNA Mature ID	hsa-miR-767-3p
miRNA Stemloop AC	MI0003763
miRNA Stemloop ID	hsa-mir-767
Sequence	ucugcucauaccccaugguuucu
TTD Target(s) Regulated by This miRNA	O-6-methylguanine-DNA-alkyltransferase (MGMT)	Clinical trial Target	Target Info	[1]
References
REF 1	In human glioblastomas transcript elongation by alternative polyadenylation and miRNA targeting is a potent mechanism of MGMT silencing. Acta Neuropathol. 2013 May;125(5):671-81.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.