miRNA General Information
miRNA Mature ID	hsa-miR-8485
miRNA Stemloop AC	MI0027288
miRNA Stemloop ID	hsa-mir-8485
Sequence	cacacacacacacacacguau
TTD Target(s) Regulated by This miRNA	TAR DNA binding protein 43 (TARDBP)	Clinical trial Target	Target Info	[1]
References
REF 1	Transcriptome-wide analysis of TDP-43 binding small RNAs identifies miR-NID1 (miR-8485), a novel miRNA that represses NRXN1 expression. Genomics. 2014 Jan;103(1):76-82.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.