miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-935 | ||||
| miRNA Stemloop AC | MI0005757 | ||||
| miRNA Stemloop ID | hsa-mir-935 | ||||
| Sequence | ccaguuaccgcuuccgcuaccgc | ||||
| TTD Target(s) Regulated by This miRNA | Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Transcription factor SOX-7 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression. Biochem Biophys Res Commun. 2016 Jan 29;470(1):68-74. | ||||
| REF 2 | miR-935 promotes gastric cancer cell proliferation by targeting SOX7.Biomed Pharmacother. 2016 Apr;79:153-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.