miRNA General Information
miRNA Mature ID	kshv-miR-K12-11-3p
miRNA Stemloop AC	MI0002474
miRNA Stemloop ID	kshv-mir-K12-11
Sequence	uuaaugcuuagccuguguccga
TTD Target(s) Regulated by This miRNA	Transcription regulator protein BACH1 (Bach1)	Clinical trial Target	Target Info	[1]
References
REF 1	Kaposi's sarcoma-associated herpesvirus encodes an ortholog of miR-155. J Virol. 2007 Dec;81(23):12836-45.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.