Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T02001 |
Target Info
|
| Target Name |
Phosphodiesterase 4D (PDE4D) |
| Synonyms |
cAMP-specific 3',5'-cyclic phosphodiesterase 4D; PDE43; DPDE3 |
| Target Type |
Successful Target |
| Gene Name |
PDE4D |
| Biochemical Class |
Phosphoric diester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-139-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucuacagugcacgugucuccagu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
RT-PCR; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
C-X-C chemokine receptor type 4 (CXCR4)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Inactivation of oncogenic cAMP-specific phosphodiesterase 4D by miR-139-5p in response to p53 activation. Elife. 2016 Jul 7;5. pii: e15978.
|
| REF 2 |
Inhibition of phosphodiesterase 4D decreases the malignant properties of DLD-1 colorectal cancer cells by repressing the AKT/mTOR/Myc signaling pat... Oncol Lett. 2019 Mar;17(3):3589-3598.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
