Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T11793 |
Target Info
|
| Target Name |
Cytochrome P450 2B6 (CYP2B6) |
| Synonyms |
Cytochrome P450 IIB1; CYPIIB6; 1,4-cineole 2-exo-monooxygenase |
| Target Type |
Literature-reported Target |
| Gene Name |
CYP2B6 |
| Biochemical Class |
Paired donor oxygen oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-25-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cauugcacuugucucggucuga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
hsa-miR-25-3p suppresses CYP2B6 expression in human liver cells via an epigenetic mechanism. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
EMSA; Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
CDK inhibitor 1C p57Kip2 (CDKN1C)
|
Target Info
|
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA hsa-miR-25-3p suppresses the expression and drug induction of CYP2B6 in human hepatocytes. Biochem Pharmacol. 2016 Aug 1;113:88-96.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
