Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T13928 Target Info
Target Name Deneddylase-1 (SENP8)
Synonyms Sentrin/SUMO-specific protease SENP8; Sentrin-specific protease 8; Protease, cysteine 2; PRSC2; NEDP1; NEDD8-specific protease 1; FKSG8; DEN1
Target Type Literature-reported Target
Gene Name SENP8
Biochemical Class Peptidase
UniProt ID
Q96LD8
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-124-3p miRNA Info
miRNA Mature AC
MIMAT0000422
Sequence uaaggcacgcggugaaugcc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
References  Top
REF 1 A biochemical approach to identifying microRNA targets. Proc Natl Acad Sci U S A. 2007 Dec 4;104(49):19291-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.