Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T14181 |
Target Info
|
| Target Name |
Telomeric repeat-binding factor 2 (TERF2) |
| Synonyms |
Telomeric DNA-binding protein; TTAGGG repeat-binding factor 2; TRF2; TRBF2 |
| Target Type |
Literature-reported Target |
| Gene Name |
TERF2 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-23a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aucacauugccagggauuucc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-23a directly targets TERF2 3'UTR. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
RT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
DNA topoisomerase I (TOP1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Mir-23a induces telomere dysfunction and cellular senescence by inhibiting TRF2 expression. Aging Cell. 2015 Jun;14(3):391-9.
|
| REF 2 |
Expression of miR-23a induces telomere shortening and is associated with poor clinical outcomes in patients with coronary artery disease. Clin Sci (Lond). 2017 Jul 13;131(15):2007-2017.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
