Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T14306 |
Target Info
|
Target Name |
CASP8-FADD-like regulator (CFLAR) |
Synonyms |
cFLIP; c-FLIP; Usurpin; MRIT; MACHrelated inducer of toxicity; MACH-related inducer of toxicity; Inhibitor of FLICE; IFLICE; I-FLICE; FLAME1; FLAME-1; FADDlike antiapoptotic molecule 1; FADD-like antiapoptotic molecule 1; Cellular FLICElike inhibitory protein; Cellular FLICE-like inhibitory protein; Casper; Caspaselike apoptosis regulatory protein; Caspaseeightrelated protein; Caspase-like apoptosis regulatory protein; Caspase-eight-related protein; Caspase homolog; CLARP; CASP8AP1; CASP8 and FADDlike apoptosis regulator subunit p12; CASP8 and FADDlike apoptosis regulator; CASP8 and FADD-like apoptosis regulator; CASH |
Target Type |
Literature-reported Target |
Gene Name |
CFLAR |
Biochemical Class |
Peptidase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-512-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aagugcugucauagcugagguc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
CASP8-FADD-like regulator (CFLAR)
|
Target Info
|
|
References |
Top |
REF 1 |
Inhibition of c-FLIP expression by miR-512-3p contributes to taxol-induced apoptosis in hepatocellular carcinoma cells. Oncol Rep. 2010 May;23(5):1457-62.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.