Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T17163 |
Target Info
|
| Target Name |
Leptin receptor (LEPR) |
| Synonyms |
OBR; OB-R; OB receptor; LEP-R; HuB219; DB; CD295 |
| Target Type |
Successful Target |
| Gene Name |
LEPR |
| Biochemical Class |
Cytokine receptor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-200c-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaauacugccggguaaugaugga
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Immunoblot; RT-PCR |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-200c mitigates invasiveness and restores sensitivity to microtubule-targeting chemotherapeutic agents. Mol Cancer Ther. 2009 May;8(5):1055-66.
|
| REF 2 |
Leptin-STAT3-G9a Signaling Promotes Obesity-Mediated Breast Cancer Progression. Cancer Res. 2015 Jun 1;75(11):2375-2386.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
