Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T25464 |
Target Info
|
| Target Name |
Calcineurin (PPP3CA) |
| Synonyms |
Serine/threonine-protein phosphatase 2B catalytic subunit alpha isoform; Calmodulin-dependent calcineurin A subunit alpha isoform; CNA; CAM-PRP catalytic subunit; CALNA |
| Target Type |
Successful Target |
| Gene Name |
PPP3CA |
| Biochemical Class |
Phosphoric monoester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
guccaguuuucccaggaaucccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The overexpression of miR-145-5p by mature miRNA precursor transfection resulted in the changed mRNA level of target PPP3CA. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR; Luciferase Reporter Assay; Microarray |
[1] |
| Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-145 induces caspase-dependent and -independent cell death in urothelial cancer cell lines with targeting of an expression signature present in Ta bladder tumors. Oncogene. 2010 Feb 18;29(7):1073-84.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
