Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T36423 Target Info
Target Name Corticotropin-releasing factor binding protein (CRHBP)
Synonyms Corticotropin-releasing hormone-binding protein; Corticotropin-releasing factor-binding protein; CRH-BP; CRFBP; CRF-binding protein; CRF-BP
Target Type Literature-reported Target
Gene Name CRHBP
UniProt ID
P24387
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-16-5p resulted in the decreased mRNA level of target CRHBP. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
References  Top
REF 1 MiR-15a and miR-16-1 cluster functions in human leukemia. Proc Natl Acad Sci U S A. 2008 Apr 1;105(13):5166-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.