Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T37848 |
Target Info
|
| Target Name |
Albendazole monooxygenase (CYP3A4) |
| Synonyms |
Taurochenodeoxycholate 6-alpha-hydroxylase; Quinine 3-monooxygenase; P450-PCN1; Nifedipine oxidase; NF-25; HLp; Cytochrome P450-PCN1; Cytochrome P450 NF-25; Cytochrome P450 HLp; Cytochrome P450 3A4; Cytochrome P450 3A3; CYPIIIA4; CYPIIIA3; CYP3A3; Albendazole sulfoxidase; Albendazole monooxygenase (sulfoxide-forming); 1,8-cineole 2-exo-monooxygenase |
| Target Type |
Clinical trial Target |
| Gene Name |
CYP3A4 |
| Biochemical Class |
Paired donor oxygen oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-27b-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucacaguggcuaaguucugc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
CYP3A4 protein was down-regulated by miR-27b. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Adenosine A2b receptor (ADORA2B)
|
Target Info
|
|
|
Albendazole monooxygenase (CYP3A4)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNAs regulate CYP3A4 expression via direct and indirect targeting. Drug Metab Dispos. 2009 Oct;37(10):2112-7.
|
| REF 2 |
The independent contribution of miRNAs to the missing heritability in CYP3A4/5 functionality and the metabolism of atorvastatin. Sci Rep. 2016 May 23;6:26544.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
