Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T39716 Target Info
Target Name Voltage-gated sodium channel alpha Nav1.5 (SCN5A)
Synonyms Voltage-gated sodium channel subunit alpha Nav1.5; Sodium channel protein type V subunit alpha; Sodium channel protein type 5 subunit alpha; Sodium channel protein cardiac muscle subunit alpha; HH1
Target Type Successful Target
Gene Name SCN5A
Biochemical Class Voltage-gated ion channel
UniProt ID
Q14524
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism miR-192-5p significantly reduced expression of SCN5A. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
References  Top
REF 1 Post-transcriptional regulation of cardiac sodium channel gene SCN5A expression and function by miR-192-5p. Biochim Biophys Acta. 2015 Oct;1852(10 Pt A):2024-34.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.