Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T43524 Target Info
Target Name Interleukin 12 receptor beta-2 (IL12RB2)
Synonyms Interleukin-12 receptor subunit beta-2; IL-12RB2; IL-12R-beta2; IL-12R-beta-2; IL-12R subunit beta-2; IL-12R beta 2; IL-12 receptor subunit beta-2; IL-12 receptor beta-2
Target Type Literature-reported Target
Gene Name IL12RB2
Biochemical Class Cytokine receptor
UniProt ID
Q99665
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-151a-3p miRNA Info
miRNA Mature AC
MIMAT0000757
Sequence cuagacugaagcuccuugagg
miRNA Species Homo sapiens
Regulation Mechanism miR-151a play an inhibitory role on IL12RB2 expression with two sites in 3' UTR of IL12RB2. Overexpression of miR-151a resulted in both decreased mRNA and protein levels of IL12RB2. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
Interleukin 12 receptor beta-2 (IL12RB2) Target Info
I12R2_HUMAN
References  Top
REF 1 MiR-151a is involved in the pathogenesis of atopic dermatitis by regulating interleukin-12 receptor 2. Exp Dermatol. 2018 Apr;27(4):427-432.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.