Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T49080 Target Info
Target Name Voltage-gated potassium channel Kv3.1 (KCNC1)
Synonyms Voltage-gated potassium channel subunit Kv4; Voltage-gated potassium channel subunit Kv3.1; Potassium voltage-gated channel subfamily C member 1; NGK2
Target Type Literature-reported Target
Gene Name KCNC1
Biochemical Class Voltage-gated ion channel
UniProt ID
P48547
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-582-5p miRNA Info
miRNA Mature AC
MIMAT0003247
Sequence uuacaguuguucaaccaguuacu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [1]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Caspase-9 (CASP9) Target Info
CASP9_HUMAN
miRNA Mature ID hsa-miR-582-3p miRNA Info
miRNA Mature AC
MIMAT0004797
Sequence uaacugguugaacaacugaacc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [1]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Geranylgeranyl transferase I (GGTase-I) Target Info
PGTB1_HUMAN
References  Top
REF 1 Therapeutic effects of microRNA-582-5p and -3p on the inhibition of bladder cancer progression. Mol Ther. 2013 Mar;21(3):610-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.