Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T49526 |
Target Info
|
| Target Name |
Voltage-gated potassium channel Kv7.1 (KCNQ1) |
| Synonyms |
Voltage-gated potassium channel subunit Kv7.1; Potassium voltage-gated channel subfamily KQT member 1; Kv7.1; KVLQT1; KQT-like 1; KCNQ1 channel; KCNA9; KCNA8; IKs producing slow voltage-gated potassium channel subunit alpha KvLQT1; IKs producing slow voltage-gated potassium channel alpha subunit KvLQT1 |
| Target Type |
Successful Target |
| Gene Name |
KCNQ1 |
| Biochemical Class |
Voltage-gated ion channel |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-133a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuugguccccuucaaccagcug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The mutation of miR-133a-3p resulted in the increased protein level of target KCNQ1. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
qPCR |
[1] |
| 2 |
Western Blot; qRT-PCR; Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Caspase-9 (CASP9)
|
Target Info
|
|
|
Fascin (FSCN1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Feedback remodeling of cardiac potassium current expression: a novel potential mechanism for control of repolarization reserve. Circulation. 2008 Sep 2;118(10):983-92.
|
| REF 2 |
Transcriptional activation by stimulating protein 1 and post-transcriptional repression by muscle-specific microRNAs of IKs-encoding genes and pote... J Cell Physiol. 2007 Aug;212(2):358-67.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
