Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T55959 Target Info
Target Name Dopamine transporter (DAT)
Synonyms Solute carrier family 6 member 3; Sodium-dependent dopamine transporter; DAT1; DAT; DA transporter
Target Type Successful Target
Gene Name SLC6A3
Biochemical Class Neurotransmitter:sodium symporter
UniProt ID
Q01959
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-491-5p miRNA Info
miRNA Mature AC
MIMAT0002807
Sequence aguggggaacccuuccaugagg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 GFP Reporter Assay; Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
References  Top
REF 1 miR-137 and miR-491 Negatively Regulate Dopamine Transporter Expression and Function in Neural Cells. Neurosci Bull. 2016 Dec;32(6):512-522.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.